Protein structure prediction assisted with sparse NMR data in CASP13

CASP13 has investigated the impact of sparse NMR data on the accuracy of protein structure prediction. NOESY and ¹⁵N-¹H residual dipolar coupling data, typical of that obtained for ¹⁵N,¹³C-enriched, perdeuterated proteins up to about 40 kDa, were simulated for 11 CASP13 targets ranging in size from 80 to 326 residues. For several targets, two prediction groups generated models that are more accurate than those produced using baseline methods. Real NMR data collected for a de novo designed protein were also provided to predictors, including one data set in which only backbone resonance assignments were available. Some NMR-assisted prediction groups also did very well with these data. CASP13 also assessed whether incorporation of sparse NMR data improves the accuracy of protein structure prediction relative to nonassisted regular methods. In most cases, incorporation of sparse, noisy NMR data results in models with higher accuracy. The best NMR-assisted models were also compared with the best regular predictions of any CASP13 group for the same target. For six of 13 targets, the most accurate model provided by any NMR-assisted prediction group was more accurate than the most accurate model provided by any regular prediction group; however, for the remaining seven targets, one or more regular prediction method provided a more accurate model than even the best NMR-assisted model. These results suggest a novel approach for protein structure determination, in which advanced prediction methods are first used to generate structural models, and sparse NMR data is then used to validate and/or refine these models.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Automatic target selection for structural genomics on eukaryotes

A central goal of structural genomics is to experimentally determine representative structures for all protein families. At least 14 structural genomics pilot projects are currently investigating the feasibility of high-throughput structure determination; the National Institutes of Health funded nine of these in the United States. Initiatives differ in the particular subset of "all families" on which they focus. At the NorthEast Structural Genomics consortium (NESG), we target eukaryotic protein domain families. The automatic target selection procedure has three aims: 1) identify all protein domain families from currently five entirely sequenced eukaryotic target organisms based on their sequence homology, 2) discard those families that can be modeled on the basis of structural information already present in the PDB, and 3) target representatives of the remaining families for structure determination. To guarantee that all members of one family share a common foldlike region, we had to begin by dissecting proteins into structural domain-like regions before clustering. Our hierarchical approach, CHOP, utilizing homology to PrISM, Pfam-A, and SWISS-PROT chopped the 103,796 eukaryotic proteins/ORFs into 247,222 fragments. Of these fragments, 122,999 appeared suitable targets that were grouped into >27,000 singletons and >18,000 multifragment clusters. Thus, our results suggested that it might be necessary to determine >40,000 structures to minimally cover the subset of five eukaryotic proteomes.     

Heterologous expression of bovine and porcine beta-lactoglobulins in Pichia pastoris: towards a comparative functional characterisation

Bovine and porcine beta-lactoglobulins were cloned and expressed in host cells with the aim of developing the tools necessary for their structural, functional and conformational characterisation by NMR techniques. Both lipocalins were expressed in Pichia pastoris, where the use of a constitutive promoter turned out to allow the highest productivity. The yield of recombinant proteins was further improved through multiple integration of the encoding genes and by increasing aeration of the transformed cultures. Both proteins were obtained in the culture medium at the concentration of 200 microg/ml. Recombinant lipocalins were purified by ion-exchange chromatography from the culture medium. A preliminary NMR characterisation showed that both proteins were correctly folded.     

Cold-shock induced high-yield protein production in Escherichia coli

Overexpression of proteins in Escherichia coli at low temperature improves their solubility and stability. Here, we apply the unique features of the cspA gene to develop a series of expression vectors, termed pCold vectors, that drive the high expression of cloned genes upon induction by cold-shock. Several proteins were produced with very high yields, including E. coli EnvZ ATP-binding domain (EnvZ-B) and Xenopus laevis calmodulin (CaM). The pCold vector system can also be used to selectively enrich target proteins with isotopes to study their properties in cell lysates using NMR spectroscopy. We have cloned 38 genes from a range of prokaryotic and eukaryotic organisms into both pCold and pET14 (ref. 3) systems, and found that pCold vectors are highly complementary to the widely used pET vectors.     

The karyology of the cyprinid genera <Emphasis Type="Italic">Scardinius</Emphasis> and <Emphasis Type="Italic">Rutilus</Emphasis> in southern Europe

The chromosomes of eight species of Rutilus and Scardinius, mostly endemic to the Italian and the Balkan peninsula, were analyzed by conventional and other banding techniques. Parallel analyses were conducted also on two leuciscine species, Alburnus albidus, for which we provide the first karyological analysis, and Leuciscus cephalus. All species examined displayed the same karyotype (2n=50 chromosomes, 8 metacentric+13 submetacentric+4 subtelo/acrocentric pairs) with nucleolus organizer regions (NORs) on the ends of the shorter arms of a medium-sized submetacentric pair. In contrast, interspecific variation was observed in the distribution of constitutive heterochromatin. The variation observed in this genomic material proved to be systematically and phylogenetically informative. Indeed, a peritelomeric C-band on the first telocentric pair characterizes species of Rutilus and Scardinius. In both genera heterochromatin differentiation appears to be directed to a centromere–telomere direction, particularly evident along the metacentric elements of their karyotypes.An erratum to this article can be found at     

Primer Prim'r: A web based server for automated primer design

The Northeast Structural Genomics Consortium (NESG) is one of nine NIH-funded pilot projects created to develop technologies needed for structural studies of proteins on a genome-wide scale. One of the most challenging aspects of this emerging field is the production of protein samples amenable to structural determination. To do this efficiently, all steps in the protein production pipeline must be automated. Here we describe the Primer program (linked from http://www-nmr.cabm.rutgers.edu/bioinformatics, www-nmr.cabm.rutgers.edu/bioinformatics, a web-based primer design program freely available to the scientific community, which was created to automate this time consuming and laborious task. This program has the ability to simultaneously calculate plasmid specific primer sets for multiple open reading frame (ORF) targets, including 96-well and greater formats. Primer includes a library of commonly used plasmid systems and possesses the ability to upload user-defined plasmid systems. In addition to calculating gene-specific annealing regions for each target, the program also adds appropriate restriction endonuclease recognition or viral recombination sites while preserving a reading frame with plasmid based fusions. Primer has several useful features such as sorting calculated primer sets by target size, facilitating interpretation of PCR amplifications by agarose gel electrophoresis, as well as supplying the molecular biologist with many important characteristics of each target such as the expected size of the PCR amplified DNA fragment and internal restriction sites. The NESG has cloned over 1500 genes using oligonucleotide primers designed by Primer.     

The NMR solution structure of the 30S ribosomal protein S27e encoded in gene RS27_ARCFU of Archaeoglobus fulgidis reveals a novel protein fold

The Archaeoglobus fulgidis gene RS27_ARCFU encodes the 30S ribosomal protein S27e. Here, we present the high-quality NMR solution structure of this archaeal protein, which comprises a C4 zinc finger motif of the CX(2)CX(14-16)CX(2)C class. S27e was selected as a target of the Northeast Structural Genomics Consortium (target ID: GR2), and its three-dimensional structure is the first representative of a family of more than 116 homologous proteins occurring in eukaryotic and archaeal cells. As a salient feature of its molecular architecture, S27e exhibits a beta-sandwich consisting of two three-stranded sheets with topology B(decreasing), A(increasing), F(decreasing), and C(increasing), D(decreasing), E(increasing). Due to the uniqueness of the arrangement of the strands, the resulting fold was found to be novel. Residues that are highly conserved among the S27 proteins allowed identification of a structural motif of putative functional importance; a conserved hydrophobic patch may well play a pivotal role for functioning of S27 proteins, be it in archaeal or eukaryotic cells. The structure of human S27, which possesses a 26-residue amino-terminal extension when compared with the archaeal S27e, was modeled on the basis of two structural templates, S27e for the carboxy-terminal core and the amino-terminal segment of the archaeal ribosomal protein L37Ae for the extension. Remarkably, the electrostatic surface properties of archaeal and human proteins are predicted to be entirely different, pointing at either functional variations among archaeal and eukaryotic S27 proteins, or, assuming that the function remained invariant, to a concerted evolutionary change of the surface potential of proteins interacting with S27.     

De novo expression of uncoupling protein 3 is associated to enhanced mitochondrial thioesterase-1 expression and fatty acid metabolism in liver of fenofibrate-treated rats

Clavaminate synthase (CAS), a 2-oxoglutarate (2OG) dependent dioxygenase, catalyses three steps in the biosynthesis of clavulanic acid. Crystals of CAS complexed with Fe(II), 2OG and deoxyguanidinoproclavaminate were exposed to nitric oxide (NO) acting as a dioxygen analogue. Prior to exposure with NO, the active site Fe(II) is octahedrally coordinated by a water molecule, the 2-oxo and 1-carboxylate groups of 2OG, and the side-chains of an aspartyl and two histidinyl residues. NO binds to the position previously occupied by the 2OG 1-carboxylate concomitant with rearrangement of the latter to the position previously occupied by the displaced water.